Journal: PLoS ONE

Article Title: IRAK4 is essential for TLR9-induced suppression of Epstein-Barr virus BZLF1 transcription in Akata Burkitt’s lymphoma cells

doi: 10.1371/journal.pone.0186614

Figure Lengend Snippet: Steps for reagent design, construction, cell line expansion and characterization are depicted. Three different custom sgRNAs (light blue bars) were designed in silico via the CRISPR Design Tool ( http://crispr.mit.edu/ ). sgRNA guide sequences were cloned into the expression plasmid pSpCas9(BB)-2A-GFP (PX458) bearing sgRNA scaffold backbone (BB), Cas9, and GFP. Cloned and sequence-verified pSpCas9(BB)-2A-GFP (PX458) plasmids were then electroporated into Akata cells, after 48h, GFP-positive cells were single cell sorted by FACS. Finally, the GFP positive single cell clones were expanded, genotyped and characterized. (Adapted from ).

Article Snippet: The annealed oligos were ligated into BpiI digested pSpCas9(BB)-2A-GFP (px458) vector, a gift from Feng Zhang (Addgene plasmid # 48138).

Techniques: In Silico, CRISPR, Clone Assay, Expressing, Plasmid Preparation, Sequencing

Journal: PLoS ONE

Article Title: IRAK4 is essential for TLR9-induced suppression of Epstein-Barr virus BZLF1 transcription in Akata Burkitt’s lymphoma cells

doi: 10.1371/journal.pone.0186614

Figure Lengend Snippet: Akata Burkitt’s lymphoma cells transfected with px458 plasmids coding for Cas9 and for sgRNA targeting TLR9 (TLR9 - b3, TLR9 - b5 and TLR9 - b6), MyD88 (MyD88 - a3, MyD88 - a5 and MyD88 - b1), IRAK4 (IRAK4 - a3 and IRAK4 - a4) and IRAK1 (IRAK1 - b2 and IRAK1 - b8), respectively, were diluted for single cell cloning, sequenced and clones containing an early stop codon were selected for further characterization. ( a ) Percentage of IgG positive cells was measured by flow cytometry. ( b ) TLR9 mRNA level was measured by RT-qPCR and normalized over HMBS and over WT Akata cells. WT Akata cells were set to 1. ( c ) IL-10 cytokine expression level measured by ELISA in the supernatant of untreated cells, and cells treated for 8h with ODN CpG 2006. ( d ) Viral BamH1 W copy numbers over cellular HMBS were determined by qPCR. ( a ) Has been performed once. ( b, c, d ) Shown is one representative experiment out of three. Data are represented as mean ± SD.

Article Snippet: The annealed oligos were ligated into BpiI digested pSpCas9(BB)-2A-GFP (px458) vector, a gift from Feng Zhang (Addgene plasmid # 48138).

Techniques: Transfection, Cloning, Clone Assay, Flow Cytometry, Quantitative RT-PCR, Expressing, Enzyme-linked Immunosorbent Assay

Journal: PLoS ONE

Article Title: IRAK4 is essential for TLR9-induced suppression of Epstein-Barr virus BZLF1 transcription in Akata Burkitt’s lymphoma cells

doi: 10.1371/journal.pone.0186614

Figure Lengend Snippet: Summary of the CRISPR Cas9 transfection and characterization experiments.

Article Snippet: The annealed oligos were ligated into BpiI digested pSpCas9(BB)-2A-GFP (px458) vector, a gift from Feng Zhang (Addgene plasmid # 48138).

Techniques: CRISPR, Transfection

Journal: Nucleic Acids Research

Article Title: Asymmetric dimerization in a transcription factor superfamily is promoted by allosteric interactions with DNA

doi: 10.1093/nar/gkad632

Figure Lengend Snippet: ( A ) Domain organization of ERRα. ( B ) ERRα DBD protein sequence and schematic secondary structure representation. ( C ) Sequence of the 26 bp DNA fragment, embERRE/IR3, used for crystallization where the two binding sites for DBD1 and DBD1 are outlined with blue and orange boxes, respectively. ( D ) Cartoon representation of the homodimer of ERRα DBD bound to the embERRE/IR3 response element, with DBD1 in light blue and DBD2 in orange color. The KR-box indicated in (B) is highlighted on the structure, in lemon green for DBD1 and teal for DBD2.

Article Snippet: The oligonucleotide DNA sequences for crystallization and ITC experiments are: The oligonucleotide DNA sequences for EMSA experiments: The single-stranded DNA oligonucleotide and its respective anti-sense DNA fragment were mixed in a ratio of 1:1 and heated in the DNA annealing buffer (10 mM Tris pH 8.0, 100 mM NaCl, 1% DMSO, 0.1 mM EDTA) at 95°C and gradually cooled down to 4°C using a BIO-RAD PCR thermocycler.

Techniques: Sequencing, Crystallization Assay, Binding Assay

Journal: Nucleic Acids Research

Article Title: Evidence of the formation of G-quadruplex structures in the promoter region of the human vascular endothelial growth factor gene

doi: 10.1093/nar/gkq926

Figure Lengend Snippet: ( A ) RT-PCR analysis of VEGF expression in A498 cells treated with DMS vehicle (control), 50 µM TMPyP2 (P2) or 25 and 50 µM TMPyP4 (P4) for 48 and 72 h. ( B ) In vivo DMS footprinting analysis of the VEGF promoter region in A498 cells treated for 24 h with DMS vehicle (lane 1) or 50 µM TMPyP4 (lane 2). Lanes A, G, T and C represent the products of sequencing reactions with the same template as a size marker. Lane M represents a 109-bp-sized marker. ( C ) Densitometric scans of the autoradiogram in (B). The gray bars indicate the guanine repeats, which are involved in G-quadruplex formation. ( D ) ChIP analysis to determine the effect of TMPyP4 on recruitment of RNA polymerase II and Sp1 to the VEGF promoter region containing the polypurine/polypyrimidine tract in A498 renal carcinoma cells treated with either DMSO control or 25 µM TMPyP4 for 48 h. Recruitment of RNA polymerase II (Pol II) and Sp1 to the VEGF proximal promoter was assessed using primers specific to the VEGF promoter. One percent of total input DNA was used as a loading control (input), and isotype-matched IgG was used as an internal control for the immunoprecipitation (IgG). ( E ) Proposed equilibrating forms of the pPu/pPy tract of the VEGF promoter in genomes. The asterisks indicate the guanine residues within the G-quadruplex-forming region that show hyperreactivity toward DMS, because they may be located within the locally unwound region or loop region of the G-quadruplex structures. ( F ) Summary of the results from both in vitro and in vivo DMS footprinting experiments. The DMS - protected guanine residues within the G-rich sequences of the VEGF promoter are indicated by open circles, and closed circles indicate the guanine residues either methylated or hypermethylated by DMS. Data shown are representative of at least two experiments.

Article Snippet: The first-strand synthesis was accomplished with a gene specific primer 1V d(CCCAGCGCCACGACCTCCGAGCTACC) spanning +23 and +49 of the promoter region annealed on genomic DNA and Vent DNA polymerase (New England Biolabs) using a thermal cycle of 10 min at 95°C, 30 min at 60°C and 10 min at 76°C as previously described ( ).

Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing, In Vivo, Footprinting, Sequencing, Marker, Immunoprecipitation, In Vitro, Methylation

Journal: Nucleic Acids Research

Article Title: Evidence of the formation of G-quadruplex structures in the promoter region of the human vascular endothelial growth factor gene

doi: 10.1093/nar/gkq926

Figure Lengend Snippet: ( A ) ChIP analysis to determine the binding of nucleolin to the VEGF promoter region containing the polypurine/polypyrimidine tract in A498 renal carcinoma cells. Recruitment of RNA Polymerase II (Pol II) (lanes 3), Sp1 (lanes 4) and nucleolin (lanes 5) to the VEGF proximal promoter was assessed using primers specific to the VEGF promoter (–248 to +48). One percent of total input DNA was used as a loading control (lane 1) and isotype-matched IgG was used as an internal control for the immunoprecipitation (lane 2). ( B ) PCR amplification of immunoprecipitated DNAs using primers specific to the 5′ upstream promoter region (–1079 to –874) of the VEGF gene as a negative control. ( C ) PCR amplification of immunoprecipitated DNAs using primers specific to the proximal promoter region (−273 to +71) of the HIF−1α gene as a positive control. Data shown are representative of at least two experiments.

Article Snippet: The first-strand synthesis was accomplished with a gene specific primer 1V d(CCCAGCGCCACGACCTCCGAGCTACC) spanning +23 and +49 of the promoter region annealed on genomic DNA and Vent DNA polymerase (New England Biolabs) using a thermal cycle of 10 min at 95°C, 30 min at 60°C and 10 min at 76°C as previously described ( ).

Techniques: Binding Assay, Immunoprecipitation, Amplification, Negative Control, Positive Control